On-Line Lab Manual for Biology 112

Bio 112
On-Line Lab Manual
(OLLM)

Lab	Resources for Lab	Plug-ins needed	Other relevant resources
Lab 01: Harvard Museum of Natural History	No Pre-lab Lab Manual	None	None
Lab 02: Skulls and Evolution	Pre-lab Lab Manual	None	None
Lab 03: Molecular Phylogeny	Pre-lab Lab Manual The Phylogenetic Tree Constructor. It uses cytochrome c protein sequences from animals and plants. The Mammalian Tree Constructor. It uses the Cytochrome Oxidase II sequences of various Mammals only.
Lab 04: Aipotu IV	Pre-lab Artificial Life Lab Manual Lab Manuals for other Aipotu WorkAreas Genetics Biochemistry Molecular Biology A sample DNA Sequence to use as a starting point for evolution: `GTATAACCATGCATAGTGGTAAACATAGTGCGCGTAGGCATCAAAGGTCATTAACCGGGGGT`	None	Download Aipotu for home use
Lab 05: Plankton	Pre-lab Lab Manual Your lab section's Blog can be found on Blackboard	None	Key to the Phytoplankton of Boston Harbor Key to the Zooplankton of Boston Harbor
Lab 06: Plant Diversity I, II, & III	Pre-lab Life Cycle Quiz Lab Manual	None	Plant Biology Sites A very useful botany site with details on plant groups and flower anatomy. Botany related web sites. Information about c-ferns A collection of pictures of vascular plants.
Lab 07: Animal Diversity I, & II	Pre-lab Lab Manual The Class' Fish Database An analysis of the pooled fish data.	Video of Squid Dissection	None
Lab 08: Animal Behavior	Pre-lab Lab Manual	None	None
Lab 09: Phylogenetic Collection	No Pre-lab Lab Manual Links to help you find organisms for your collection: NOTE: Use ONLY these sites when determining the phyla for your collection. No other sources are considered valid for this lab. A list of Animal Phyla with links. A list of Bacterial Phyla with links. A list of Fungal Phyla with links. A list of Plant Phyla with links. A list of Protist Phyla with links. The Taxonomy Site for the Lab DO NOT USE THIS WHEN MAKING YOUR COLLECTIONS!!! This is only for use DURING the lab session.	None	Useful sites for the Phylogeny Collection Project The "Tree of Life" - pictures of organisms organized by phylum Pictures of animals organized by phylum. Microbes involved in dairy products.