Customizing the Genex Applet using Parameters
You can customize the Genex Applet to allow students to study a gene you have specified.
If you do not specify a parameter, Genex will use the default value given below.
The parameters are as follows:
- Gene Sequence:
- Parameter name="DNA_SEQUENCE".
- The DNA sequence of the default gene.
- The sequence can be any length.
- The sequence must be specified as a single
long line with no spaces or carriage returns.
- Default value = "CAAGGCTATAACCGAGATTG
ATGCCTTGTGCGATAAGGTG
TGTCCCCCCCCAAAGTGTCG
GATGTCGAGTGCGCGTGCAA
AAAAAAACAAAGGCGAGGAC
CTTAAGAAGGTGTGAGGGGG
CGCTCGAT"
- Promoter Sequence:
- Parameter name="PROMOTER".
- The DNA sequence recognized as a promoter.
- The sequence can be any length.
- Default value = "TATAA"
- Terminator Sequence:
- Parameter name="TERMINATOR".
- The DNA sequence recognized as a transcription terminator.
- The sequence can be any length.
- Default value = "GGGGG"
- Intron Start Sequence:
Parameter name="INTRON_START".
- The RNA sequence recognized as the start (5' end) of an intron.
- The sequence can be any length.
- If you set this to "none", introns will be ignored; this simulates a
prokaryotic gene.
- Default value = "GUGCG"
Intron End Sequence:
- Parameter name="INTRON_END".
- The RNA sequence recognized as the end (3' end) of an intron.
- The sequence can be any length.
- Default value = "CAAAG"
Poly-A tail Sequence:
- Parameter name="POLY_A_TAIL".
- The RNA sequence added on to the 3- end of the mRNA.
- The sequence can be any length.
- Default value = "AAAAAAAAAAAAA"
Enable Printing:
- Parameter name="PRINTING".
- Whether or not the user can print the DNA, RNA, and protein sequences.
- If this parameter = "TRUE", printing is enabled.
- Default value = not allowed.
- A sample web page where Genex can print.
Parameters can be specified in any order.
Here is a sample:
<html>
<head>
<title>testing</title>
</head>
<body>
<applet code="GenexApplet.class" archive="genex.jar" width=800 height=500>
<PARAM NAME="DNA_SEQUENCE" VALUE="TAAGGCTATAACCGAGATTGATGCCTTGTGCGATAAGGTGTGTCCCCCCCCAAAGTGTCGGATGTCGAGTGCGCGTGCAAAAAAAAACAAAGGCGAGGACCTTAAGAAGGTGTGAGGGGGCGCTCGAT">
<PARAM NAME="PRINTING" VALUE="TRUE">
</applet>
<hr>
</body>
</html>
</code>
You will need to include the genex.jar file in the same directory
on the server as the html file.
Contact Brian White if you have questions.